Genome Logic Modeling Project

Reading regulatory logic
from sequence

The control layer of the genome is written in a logical grammar. Transcription factor binding motifs are its alphabet; their spatial arrangement in promoter and enhancer sequences encodes AND, OR, NOT, and feedback. GLMP is a systematic program to decode that grammar — to build the corpus, infrastructure, and framework needed to read any regulatory sequence as a logical formula.

E. coli lac operon — origin circuit · lacO1 operator (NOT gate) + CRP site (AND input)

5'–AATTGTGAGCGGATAACAATT···~60 bp···TGTGANNNNNNTCACA–3'
RED  lacO1 · NOT gate · LacI repressor binding · 21 bp
BLUE  CRP site · AND input · catabolite activation · ~22 bp
~60 bp  inter-site distance → OR-independent geometry → AND circuit logic

Paper series

The GLMP series

Five working papers form the foundation. The methods paper introduces the unit of representation. Papers I–II develop the grammar. Paper III delivers the first empirical test.


Flowchart corpus

217 circuits. 8 organisms.

217
Typed flowcharts
8
Organisms
527
Feedback loops
5
Complexity classes

Each flowchart encodes the logical structure of a regulatory circuit — AND gates, NOT gates, feedback topology, and complexity class. The corpus is the training data construction phase of the grammar-decoding program. A sequence annotation layer is in progress, linking each binding-event node to its DNA sequence and position weight matrix.

Browse the corpus on HuggingFace →

Infrastructure

CopernicusAI & the DNA Decoder

CopernicusAI

~59,700 indexed research papers from PubMed, bioRxiv, and arXiv. Dense retrieval with OpenAI text-embedding-3-small (nDCG@10 = 0.828). Daily ingest pipeline running on a Jetson Nano edge compute node.

Browse on HuggingFace →

DNA Decoder — prototype

A five-stage pipeline: sequence in → motif scanning (FIMO/JASPAR) → GLMP grammar rule parsing → protein annotation → Biolink-compliant property graph out. Prototype in development on prokaryotic ground-truth circuits.

GitHub Repository

Working papers, flowchart source files, sequence annotation schema, and collaboration infrastructure for the Welz & Krampis collaboration.

github.com/garywelz/glmp →

Contact & affiliation

Gary Welz

Affiliation New Media Lab, CUNY Graduate Center
GitHub garywelz/glmp